Name: Laser-Capture-Mikrodissektion von paraformaldehydfixiertem Mauslebergewebe zur RNA-Analyse (Video) | JoVE Journal
Uploaded: 2026-04-17T12:33:00.000+00:00
Duration: 9 min 21 s
Description: Erfahren Sie die Laser-Capture-Mikrodissektion von PFA-fixiertem Mauslebergewebe für räumlich aufgelöste Transkriptomanalysen. Diese Methode liefert hochwertige RNA für qPCR und Sequenzierung.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Shapiro, E., Biezuner, T., Linnarsson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+sequencing-based+technologies+will+revolutionize+whole-organism+science%5BTitle%5D)+AND+%22Nat+Rev+Genet%22%5BJournal%5D)">Single-cell sequencing-based technologies will revolutionize whole-organism science.</a> Nat Rev Genet. 14 (9), 618-630 (2013).</li>
<li>Halpern, K. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+spatial+reconstruction+reveals+global+division+of+labour+in+the+mammalian+liver%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Single-cell spatial reconstruction reveals global division of labour in the mammalian liver.</a> Nature. 543 (7647), 352-356 (2017).</li>
<li>Aizarani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+human+liver+cell+atlas+reveals+heterogeneity+and+epithelial+progenitors%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">A human liver cell atlas reveals heterogeneity and epithelial progenitors.</a> Nature. 572 (7768), 199-204 (2019).</li>
<li>Van Den Brink, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+sequencing+reveals+dissociation-induced+gene+expression+in+tissue+subpopulations%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Single-cell sequencing reveals dissociation-induced gene expression in tissue subpopulations.</a> Nat Methods. 14 (10), 935-936 (2017).</li>
<li>Baron, C. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+Type+Purification+by+Single-Cell+Transcriptome-Trained+Sorting%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Cell Type Purification by Single-Cell Transcriptome-Trained Sorting.</a> Cell. 179 (2), 527-542.e19 (2019).</li>
<li>Gross, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Technologies+for+Single-Cell+Isolation%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Technologies for Single-Cell Isolation.</a> Int J Mol Sci. 16 (8), 16897-16919 (2015).</li>
<li>Dries, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Advances+in+spatial+transcriptomic+data+analysis%5BTitle%5D)+AND+%22Genome+Res%22%5BJournal%5D)">Advances in spatial transcriptomic data analysis.</a> Genome Res. 31 (10), 1706-1718 (2021).</li>
<li>Chen, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Spatiotemporal+transcriptomic+atlas+of+mouse+organogenesis+using+DNA+nanoball-patterned+arrays%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Spatiotemporal transcriptomic atlas of mouse organogenesis using DNA nanoball-patterned arrays.</a> Cell. 185 (10), 1777-1792.e21 (2022).</li>
<li>Ståhl, P. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Visualization+and+analysis+of+gene+expression+in+tissue+sections+by+spatial+transcriptomics%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Visualization and analysis of gene expression in tissue sections by spatial transcriptomics.</a> Science. 353 (6294), 78-82 (2016).</li>
<li>Espina, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser-capture+microdissection%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Laser-capture microdissection.</a> Nat Protoc. 1 (2), 586-603 (2006).</li>
<li>Baba, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+expression+profiling+in+biliary+epithelial+cells+of+primary+biliary+cirrhosis+using+laser+capture+microdissection+and+cDNA+microarray%5BTitle%5D)+AND+%22Transl+Res%22%5BJournal%5D)">Gene expression profiling in biliary epithelial cells of primary biliary cirrhosis using laser capture microdissection and cDNA microarray.</a> Transl Res. 148 (3), 103-113 (2006).</li>
<li>Mena, J. E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+capture+microdissection+after+%CE%B3-glutamyl+transferase+histochemistry%3A+An+optimization+for+gene+expression+analysis%5BTitle%5D)+AND+%22Anal+Biochem%22%5BJournal%5D)">Laser capture microdissection after γ-glutamyl transferase histochemistry: An optimization for gene expression analysis.</a> Anal Biochem. 447, 126-132 (2014).</li>
<li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Next-generation+RNA+Sequencing+of+Archival+Formalin-fixed+Paraffin-embedded+Urothelial+Bladder+Cancer%5BTitle%5D)+AND+%22Eur+Urol%22%5BJournal%5D)">Next-generation RNA Sequencing of Archival Formalin-fixed Paraffin-embedded Urothelial Bladder Cancer.</a> Eur Urol. 66 (6), 982-986 (2014).</li>
<li>Ludyga, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nucleic+acids+from+long-term+preserved+FFPE+tissues+are+suitable+for+downstream+analyses%5BTitle%5D)+AND+%22Virchows+Arch%22%5BJournal%5D)">Nucleic acids from long-term preserved FFPE tissues are suitable for downstream analyses.</a> Virchows Arch. 460 (2), 131-140 (2012).</li>
<li>Mägel, L., Bartels, S., Lehmann, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Next-Generation+Sequencing+Analysis+of+Laser-Microdissected+Formalin-Fixed+and+Paraffin-Embedded+%28FFPE%29+Tissue+Specimens%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Next-Generation Sequencing Analysis of Laser-Microdissected Formalin-Fixed and Paraffin-Embedded (FFPE) Tissue Specimens.</a> Methods Mol Biol. 1723, 111-118 (2018).</li>
<li>Von Ahlfen, S., Missel, A., Bendrat, K., Schlumpberger, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Determinants+of+RNA+Quality+from+FFPE+Samples%5BTitle%5D)+AND+%22PLoS+One%22%5BJournal%5D)">Determinants of RNA Quality from FFPE Samples.</a> PLoS One. 2 (12), e1261(2007).</li>
<li>Böhm, M., Wieland, I., Schütze, K., Rübben, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microbeam+MOMeNT%3A+non-contact+laser+microdissection+of+membrane-mounted+native+tissue%5BTitle%5D)+AND+%22Am+J+Pathol%22%5BJournal%5D)">Microbeam MOMeNT: non-contact laser microdissection of membrane-mounted native tissue.</a> Am J Pathol. 151 (1), 63-67 (1997).</li>
<li>Schütze, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cut+out+or+poke+in--the+key+to+the+world+of+single+genes%3A+laser+micromanipulation+as+a+valuable+tool+on+the+look-out+for+the+origin+of+disease%5BTitle%5D)+AND+%22Genet+Anal%22%5BJournal%5D)">Cut out or poke in--the key to the world of single genes: laser micromanipulation as a valuable tool on the look-out for the origin of disease.</a> Genet Anal. 14 (1), 1-8 (1997).</li>
<li>Datta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+capture+microdissection%3A+Big+data+from+small+samples%5BTitle%5D)+AND+%22Histol+Histopathol%22%5BJournal%5D)">Laser capture microdissection: Big data from small samples.</a> Histol Histopathol. 30 (11), 1255-1269 (2015).</li>
<li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NanoDrop+microvolume+quantitation+of+nucleic+acids%5BTitle%5D)+AND+%22J+Vis+Exp%22%5BJournal%5D)">NanoDrop microvolume quantitation of nucleic acids.</a> J Vis Exp. (45), e2565(2010).</li>
<li>Ge, S. J., Gan, W. Q., Karlinsey, K., Zhou, B. Y., Pachter, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Immuno-laser+capture+microdissection+of+perfusion-fixed+mouse+brain+tissue+coupled+to+RNA-seq%5BTitle%5D)+AND+%22J+Neurosci+Methods%22%5BJournal%5D)">Immuno-laser capture microdissection of perfusion-fixed mouse brain tissue coupled to RNA-seq.</a> J Neurosci Methods. 423, 110548(2025).</li>
<li>Takahashi, K., Beltran, W. A., Sudharsan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+optimized+workflow+for+transcriptomic+analysis+from+archival+paraformaldehyde-fixed+retinal+tissues+collected+by+laser+capture+microdissection%5BTitle%5D)+AND+%22Exp+Eye+Res%22%5BJournal%5D)">An optimized workflow for transcriptomic analysis from archival paraformaldehyde-fixed retinal tissues collected by laser capture microdissection.</a> Exp Eye Res. 246, 109989(2024).</li>
<li>Mahalingam, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+Capture+Microdissection%3A+Insights+into+Methods+and+Applications%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Laser Capture Microdissection: Insights into Methods and Applications.</a> Methods Mol Biol. 1723, 1-17 (2018).</li>
<li>Kim, S. O., Kim, J., Okajima, T., Cho, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mechanical+properties+of+paraformaldehyde-treated+individual+cells+investigated+by+atomic+force+microscopy+and+scanning+ion+conductance+microscopy%5BTitle%5D)+AND+%22Nano+Converg%22%5BJournal%5D)">Mechanical properties of paraformaldehyde-treated individual cells investigated by atomic force microscopy and scanning ion conductance microscopy.</a> Nano Converg. 4 (1), (2017).</li>
<li>Erickson, H. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Quantitative+RT-PCR+gene+expression+analysis+of+laser+microdissected+tissue+samples%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Quantitative RT-PCR gene expression analysis of laser microdissected tissue samples.</a> Nat Protoc. 4 (6), 902-922 (2009).</li>
<li>Pan, D. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+Capture+Microdissection-Based+RNA+Microsequencing+Reveals+Optic+Nerve+Crush-Related+Early+mRNA+Alterations+in+Retinal+Ganglion+Cell+Layer%5BTitle%5D)+AND+%22Transl+Vis+Sci+Technol%22%5BJournal%5D)">Laser Capture Microdissection-Based RNA Microsequencing Reveals Optic Nerve Crush-Related Early mRNA Alterations in Retinal Ganglion Cell Layer.</a> Transl Vis Sci Technol. 9 (11), 30(2020).</li>
<li>Civita, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Laser+Capture+Microdissection+and+RNA-Seq+Analysis%3A+High+Sensitivity+Approaches+to+Explain+Histopathological+Heterogeneity+in+Human+Glioblastoma+FFPE+Archived+Tissues%5BTitle%5D)+AND+%22Front+Oncol%22%5BJournal%5D)">Laser Capture Microdissection and RNA-Seq Analysis: High Sensitivity Approaches to Explain Histopathological Heterogeneity in Human Glioblastoma FFPE Archived Tissues.</a> Front Oncol. 9, 482(2019).</li>
<li>Phan, H. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput+RNA+sequencing+of+paraformaldehyde-fixed+single+cells%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">High-throughput RNA sequencing of paraformaldehyde-fixed single cells.</a> Nat Commun. 12 (1), 5636(2021).</li>
<li>Thomsen, E. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fixed+single-cell+transcriptomic+characterization+of+human+radial+glial+diversity%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Fixed single-cell transcriptomic characterization of human radial glial diversity.</a> Nat Methods. 13 (1), 87-93 (2016).</li>
<li>Lin, X. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+comparative+analysis+of+RNA+sequencing+methods+with+ribosome+RNA+depletion+for+degraded+and+low-input+total+RNA+from+formalin-fixed+and+paraffin-embedded+samples%5BTitle%5D)+AND+%22Bmc+Genomics%22%5BJournal%5D)">A comparative analysis of RNA sequencing methods with ribosome RNA depletion for degraded and low-input total RNA from formalin-fixed and paraffin-embedded samples.</a> Bmc Genomics. 20 (1), 831(2019).</li>
<li>Luzzi, V., Mahadevappa, M., Raja, R., Warrington, J. A., Watson, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Accurate+and+reproducible+gene+expression+profiles+from+laser+capture+microdissection%2C+transcript+amplification%2C+and+high+density+oligonucleotide+microarray+analysis%5BTitle%5D)+AND+%22J+Mol+Diagn%22%5BJournal%5D)">Accurate and reproducible gene expression profiles from laser capture microdissection, transcript amplification, and high density oligonucleotide microarray analysis.</a> J Mol Diagn. 5 (1), 9-14 (2003).</li>
</ol>

<table><tbody><tr><td><stark>Material</stark></td><td></td><td></td><td></td></tr><tr><td>0,2 ml Dünnwandröhren</td><td>Axygen</td><td>PCR-02-C</td><td>Röhren zur LCM-Sammlung</td></tr><tr><td>1,5 mL Zentrifugenröhre</td><td>Axygen</td><td>339653</td><td></td></tr><tr><td>4 % Paraformaldehyd</td><td>Leagene</td><td>DF0135</td><td></td></tr><tr><td>50 mL Zentrifugenrohr</td><td>ThermoFisher Scientific</td><td>339653</td><td></td></tr><tr><td>DEPC (Diethylpyrocarbonat)</td><td>Sigma</td><td>D-5758</td><td></td></tr><tr><td>DNase-I-Verdauungsset</td><td>Qiagen</td><td>73504</td><td>Ein Bauteil des RNeasy FFPE Kit enthält DNase I Standardlösung und DNase Booster Buffer</td></tr><tr><td>Ethanol (100 %)</td><td>Thermo Fisher Scientific</td><td>BP2818</td><td>Gereinigt für Molekularbiologie</td></tr><tr><td>Ethanolbasierter Waschpuffer</td><td>Qiagen</td><td>73504</td><td>Puffer-RPE (Komponente des RNeasy FFPE Kits)</td></tr><tr><td>Hochsalzwasserpuffer</td><td>Qiagen</td><td>73504</td><td>Puffer-RBC (Komponente des RNeasy FFPE Kits)</td></tr><tr><td>Niedrigprofilige Mikrotom-Klingen</td><td>Leica Biosystems</td><td>819</td><td></td></tr><tr><td>Mayer' s Hämatoxylin</td><td>Leagene</td><td>DH0001</td><td></td></tr><tr><td>OCT-Verbindung</td><td>Sakura</td><td>4583</td><td></td></tr><tr><td>PEN-membranbeschichtete Rutsche</td><td>Leica</td><td>11505188</td><td></td></tr><tr><td>Phosphatgepufferte Kochsalzlösung</td><td>Leagene</td><td>CC0010</td><td>DNase/RNase-frei</td></tr><tr><td>Poly-L-lysin</td><td>Macklin</td><td>P875131S</td><td></td></tr><tr><td>Proteinase-K-Verdauungspuffer</td><td>Qiagen</td><td>73504</td><td>Puffer-PKD (Komponente des RNeasy FFPE Kits)</td></tr><tr><td>Reinigungssäule</td><td>Qiagen</td><td>73504</td><td>RNeasy MinElute-Spin-Säule (Komponente des RNeasy FFPE Kits)</td></tr><tr><td>Quantitativer PCR-Mastermix</td><td>Takara-Biografie</td><td>RR820A</td><td>TB Green Premix Ex Taq II (Tli RNaseH Plus)</td></tr><tr><td>Reverse-Transkriptions-Kit</td><td>Qiagen</td><td>205411</td><td>QuantiNova Reverse-Transkriptions-Kit</td></tr><tr><td>RNA-Extraktionskit</td><td>Qiagen</td><td>73504</td><td>RNeasy FFPE-Kit</td></tr><tr><td>RNA-Sequenzierungs-Kit (Niedrig-Input, Strang)</td><td>Takara-Biografie</td><td>634412</td><td>SMARTer-Strang-Total-RNA-Seq-Kit – Pico-Eingabe-Säugetier-V2</td></tr><tr><td>RNase-Dekontaminationsmittel</td><td>Solarbio</td><td>SR0040</td><td>Reinigung</td></tr><tr><td>Sucrose</td><td>Macklin</td><td>S818049</td><td></td></tr><tr><td><stark>Tiere und Futter</stark></td><td></td><td></td><td></td></tr><tr><td>Maus: C57BL/6J</td><td>Labortierzentrum der Provinz Guangdong</td><td>03</td><td></td></tr><tr><td><stark>Spezialdiät & Trinkwasser</stark></td><td></td><td></td><td></td></tr><tr><td>Fettreiche, cholinarme Ernährung (Basisdiät)</td><td>TROPHIC Animal Feed High-Tech Co., Ltd.</td><td>TP36310M</td><td>Makronährstoffe: Protein, 14 kcal%; Kohlenhydrate, 26 kcal%; Fett, 60 kcal%)</td></tr><tr><td>Zuckerhaltiges Trinkwasser</td><td>Macklin</td><td>N/A (intern vorbereitet)</td><td>Eine Mischung aus D-Glukose (Macklin, Cat# F87500) und D-Fruktose (Macklin, Cat# S818049) wurde dem autoklavierten Trinkwasser mit einer Endkonzentration von 42 g/L zugesetzt, mit einem Glukose-Fructose-Verhältnis von 55:45 (w/w)</td></tr><tr><td><stark>Mausprimer</stark></td><td></td><td></td><td></td></tr><tr><td>&beta;-actin (Vorwärts: AGAGGGAAATCGTGCGTGAC )</td><td>BGI-Sequenzierung</td><td>Angepasst</td><td>HPLC gereinigt</td></tr><tr><td>&beta;-actin (Rückwärts: CAATAGTGATGACCTGGCCGT)</td><td>BGI-Sequenzierung</td><td>Angepasst</td><td>HPLC gereinigt</td></tr><tr><td><stark>Ausrüstung</stark></td><td></td><td></td><td></td></tr><tr><td>Kryostat-Mikrotom</td><td>Leica Biosystems</td><td>CM3050 S</td><td></td></tr><tr><td>Bioanalysator-System</td><td>Agilent</td><td>G2939BA</td><td></td></tr><tr><td>Hochdurchsatz-Sequenzierungsplattform</td><td>Illumina; Inc.</td><td>NovaSeq 6000 System</td><td></td></tr><tr><td>Lasererfassungs-Mikrodissektionssystem</td><td>Leica Microsystems</td><td>Leica LMD6500</td><td></td></tr><tr><td>Quantitatives PCR-System</td><td>Angewandte Biosysteme</td><td>QuantStudio 5 Echtzeit-PCR-System</td><td></td></tr><tr><td>Spektrophotometer</td><td>ThermoFisher Scientific</td><td>NP80</td><td>NanoDrop</td></tr><tr><td>Thermischer Zykler</td><td>BioRad</td><td>T100</td><td></td></tr><tr><td><stark>Software</stark></td><td></td><td></td><td></td></tr><tr><td>Adobe Illustrator CC 2019 (Version 23.0.2)</td><td>Adobe</td><td>https://www.adobe.com/products/illustrator.html</td><td></td></tr><tr><td>GraphPad Prism (Version 8.3.0)</td><td>GraphPad-Software</td><td>https://www.graphpad.com</td><td></td></tr></tbody></table>

laser-capture-mikrodissektion von paraformaldehydfixiertem mauslebergewebe zur rna-analyse

Laser Capture Microdissection of Paraformaldehyde-Fixed Mouse Liver Tissue for RNA Analysis

Laser-Capture-Mikrodissektion von paraformaldehydfixiertem Mauslebergewebe zur RNA-Analyse

Laser capture microdissection (LCM) provides spatial access to specific cell populations within complex tissues through in situ visualization and ...

laser-capture-microdissection-paraformaldehyde-fixed-mouse-liver

Research

Forschung

JoVE Journal

Biology

Biologie

Die Profilierung der RNA-Expression in diskreten Regionen des Mausgehirns erfordert eine präzise und reproduzierbare Strategie zur Gewinnung von Gewebeproben. Hier wird ein Protokoll beschrieben, das sowohl die koronare Schnittführung des Gehirns als auch die mikrodissektionsbasierte Gewebeentnahme mithilfe eines Gewebecorers nutzt. Die Ausbeute und Qualität der gesamten RNA aus den resultierenden Proben bestätigt die Eignung der dargestellten Methode.

Non-Laser Capture Microscopy Ansatz für die Mikrodissektion von Discrete-Maus Hirnregionen für Gesamt-RNA Isolierung und Downstream Next-Generation Sequencing and Gene Expression Profiling

Genexpressionsanalyse einer Untergruppe von Zellen in einem spezifischen Gewebe stellt eine große Herausforderung. Dieser Artikel beschreibt, wie man qualitativ hochwertige Gesamt-RNA aus einer bestimmten Zellpopulation durch die Kombination einer schnellen Immunomarkierung Verfahren mit Laser Mikrodissektion zu isolieren.

RNA-Isolierung aus zellspezifische Subpopulationen Mit Laser-Mikrodissektion In Verbindung mit Rapid-Immunmarkierung

Hier beschreiben wir ein vereinfachtes Protokoll für microRNA (miRNA)-Expressionsanalysen in archivierten klinischen Geweben mit Formalin-fixiertem, Paraffin-eingebettetem (FFPE) oder frisch gefrorenem Prostatakrebs (PCa) unter Verwendung von quantitativer Echtzeit-PCR (RT-PCR) und in situ Hybridisierung (ISH).

miRNA-Expressionsanalysen in Prostate Cancer Clinical Tissues

Das Ziel dieses Protokolls ist es, die Laser-Capture-Mikrodissektion als effektive Methode zur Isolierung reiner Populationen von Zelltypen aus heterogenem Prostatagewebe für die nachgeschaltete RNA-Analyse zu verwenden.

Laser-Mikrodissektion für Menschen Prostataepithel für die RNA-Analyse

Hier beschreiben wir ein Protokoll für eine reproduzierbare Laser Capture Microdissection (LCM) zur Isolierung von trabekuläre Geflecht (TM) für die nachgelagerten RNA-Analyse. Die Fähigkeit, Veränderungen in der Genexpression im TM zu analysieren hilft beim Verständnis der zugrunde liegenden molekularen Mechanismen der TM-okulären Erkrankungen.

Laser Capture Microdissection von hochreinen trabekuläre Geflecht aus Maus Augen für Gene Expression Analysis

Wir präsentieren eine robuste, kostengünstige und flexible Methode zur Messung von Veränderungen der Hepatozytenzahl und der Kernploidie in festen/kryokonservierten Gewebeproben, die keine Durchflusszytometrie erfordern. Unser Ansatz bietet eine leistungsstarke probenweite Signatur der Leberzytologie, ideal für die Verfolgung des Fortschreitens von Leberverletzungen und Krankheiten.

A High-Throughput In Situ Method for Estimation of Hepatocyte Nuclear Ploidy in Mice

Ein Lasercapture Microdissection (LCM) Protokoll wurde entwickelt, um eine ausreichende Menge an hochwertiger RNA für die Genexpressionsanalyse in Knochenzellen zu erhalten. Die aktuelle Studie konzentriert sich auf Mausfemurabschnitte. Das hier berichtete LCM-Protokoll kann jedoch verwendet werden, um die Genexpression in Zellen von hartgeweben zu untersuchen.

Ein Laser Capture Microdissection Protocol, das hochwertige RNA aus frisch gefrorenen Mausknochen liefert

Die Übersetzung der Ribosomenaffinitätsreinigung (TRAP) ermöglicht eine schnelle und effiziente Isolierung der zelltypspezifischen mRNA. Hier zeigen wir eine Methode, die hydrodynamische Schwanzveneninjektion in einem Mausmodell der Leberrepopulation und TRAP kombiniert, um das Expressionsprofil von wiederbevölkerten Hepatozyten zu untersuchen.

Zelltypspezifische Gene Expression Profiling in der Mausleber

Dieses Protokoll beschreibt lasercapture microdissection for the isolation of knorpel and bone from fresh frozen sections of the mouse embryo. Knorpel und Knochen können durch Kresylviolettfärbung schnell visualisiert und präzise gesammelt werden, um hochwertige RNA für die transkriptomische Analyse zu liefern.

Laser Capture Mikrodissektion von Maus embryonalen Knorpel und Knochen für Die Genexpressionsanalyse

Lasermikrodissektion (LMD) ist eine empfindliche und hochreproduzierbare Technik, die verwendet werden kann, um Wege aufzudecken, die Gliomheterogenität und Invasion vermitteln. Hier beschreiben wir ein optimiertes Protokoll zur Isolierung diskreter Bereiche aus Gliomgewebe mittels Laser LMD, gefolgt von transkriptomischer Analyse.

Lasercapture Mikrodissektion von Glioma Subregionen für räumliche und molekulare Charakterisierung der intratumoralen Heterogenität, Oncostreams und Invasion

Hier wird ein Protokoll zur Laser-Capture-Mikrodissektion (LCM) von Pflanzengeweben vorgestellt. LCM ist eine mikroskopische Technik zur kontaminationsfreien Isolierung von Gewebebereichen. Das Verfahren umfasst Gewebefixierung, Paraffineinbettung, Schnitt, LCM und RNA-Extraktion. RNA wird in der nachgeschalteten gewebespezifischen, zeitlich aufgelösten Analyse von Transkriptomen eingesetzt.

Laser-Capture Microdissection RNA-Sequenzierung für räumliche und zeitliche gewebespezifische Genexpressionsanalyse in Pflanzen

Erfahren Sie die Laser-Capture-Mikrodissektion von PFA-fixiertem Mauslebergewebe für räumlich aufgelöste Transkriptomanalysen. Diese Methode liefert hochwertige RNA für qPCR und Sequenzierung.

Laser-Capture-Mikrodissektion von paraformaldehydfixiertem Mauslebergewebe zur RNA-Analyse

Weitere Videos entdecken