Name: Op elektroporatie gebaseerde CRISPR-Cas9-gemedieerde genknock-out in THP-1-cellen en isolatie van eencellige klonen (Video) | JoVE Journal
Uploaded: 2025-02-28T12:30:00.000+00:00
Duration: 9 min 29 s
Description: Leer CRISPR-Cas9-genbewerking in THP-1-cellen via elektroporatie voor onderzoek naar HIV-resistentie bij macrofagen. Dit protocol maakt efficiënte genknock-out en isolatie van eencellige klonen mogelijk.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Tsuchiya, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Establishment+and+characterization+of+a+human+acute+monocytic+leukemia+cell+line+%28THP-1%29%5BTitle%5D)+AND+%22Int+J+Cancer%22%5BJournal%5D)">Establishment and characterization of a human acute monocytic leukemia cell line (THP-1).</a> Int J Cancer. 26 (2), 171-176 (1980).</li>
<li>Danis, V. A., Millington, M., Hyland, V. J., Grennan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cytokine+production+by+normal+human+monocytes%3A+inter-subject+variation+and+relationship+to+an+IL-1+receptor+antagonist+%28IL-lRa%29+gene+polymorphism%5BTitle%5D)+AND+%22Clin+Exp+Immunol%22%5BJournal%5D)">Cytokine production by normal human monocytes: inter-subject variation and relationship to an IL-1 receptor antagonist (IL-lRa) gene polymorphism.</a> Clin Exp Immunol. 99, https://academic.oup.com/cei/article/99/2/303/6484286 (1995).</li>
<li>Bol, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Donor+variation+in+in+vitro+HIV-1+susceptibility+of+monocyte-derived+macrophages%5BTitle%5D)+AND+%22Virology%22%5BJournal%5D)">Donor variation in in vitro HIV-1 susceptibility of monocyte-derived macrophages.</a> Virology. 390 (2), 205-211 (2009).</li>
<li>Appleby, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sources+of+heterogeneity+in+human+monocyte+subsets%5BTitle%5D)+AND+%22Immunol+Lett%22%5BJournal%5D)">Sources of heterogeneity in human monocyte subsets.</a> Immunol Lett. 152 (1), 32-41 (2013).</li>
<li>O'Neill, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Single-cell+and+bulk+RNA-sequencing+reveal+differences+in+monocyte+susceptibility+to+Influenza+A+virus+infection+between+Africans+and+Europeans%5BTitle%5D)+AND+%22Front+Immunol%22%5BJournal%5D)">Single-cell and bulk RNA-sequencing reveal differences in monocyte susceptibility to Influenza A virus infection between Africans and Europeans.</a> Front Immunol. 12, 768189(2021).</li>
<li>Wen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Comparability+study+of+monocyte-derived+dendritic+cells%2C+primary+monocytes%2C+and+THP1+cells+for+innate+immune+responses%5BTitle%5D)+AND+%22J+Immunol+Methods%22%5BJournal%5D)">Comparability study of monocyte-derived dendritic cells, primary monocytes, and THP1 cells for innate immune responses.</a> J Immunol Methods. 498, 113147(2021).</li>
<li>Inagaki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interferon-g-induced+apoptosis+and+activation+of+THP-1+macrophages%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">Interferon-g-induced apoptosis and activation of THP-1 macrophages.</a> Life Sci. 71 (21), 2499-2508 (2002).</li>
<li>Boonkaewwan, C., Toskulkao, C., Vongsakul, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anti-inflammatory+and+immunomodulatory+activities+of+stevioside+and+its+metabolite+steviol+on+THP-1+cells%5BTitle%5D)+AND+%22J+Agric+Food+Chem%22%5BJournal%5D)">Anti-inflammatory and immunomodulatory activities of stevioside and its metabolite steviol on THP-1 cells.</a> J Agric Food Chem. 54 (3), 785-789 (2006).</li>
<li>Chanput, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((%CE%B2-Glucans+are+involved+in+immune-modulation+of+THP-1+macrophages%5BTitle%5D)+AND+%22Mol+Nutr+Food+Res%22%5BJournal%5D)">β-Glucans are involved in immune-modulation of THP-1 macrophages.</a> Mol Nutr Food Res. 56 (5), 822-833 (2012).</li>
<li>Cui, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((USP3+inhibits+type+I+interferon+signaling+by+deubiquitinating+RIG-I-like+receptors%5BTitle%5D)+AND+%22Cell+Res%22%5BJournal%5D)">USP3 inhibits type I interferon signaling by deubiquitinating RIG-I-like receptors.</a> Cell Res. 24 (4), 400-416 (2014).</li>
<li>Chen, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SAMHD1+suppresses+innate+immune+responses+to+viral+infections+and+inflammatory+stimuli+by+inhibiting+the+NF-%CE%BAB+and+interferon+pathways%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+USA%22%5BJournal%5D)">SAMHD1 suppresses innate immune responses to viral infections and inflammatory stimuli by inhibiting the NF-κB and interferon pathways.</a> Proc Natl Acad Sci USA. 115 (16), E3798-E3807 (2018).</li>
<li>Pradhananga, S., Spalinskas, R., Poujade, F. A., Eriksson, P., Sahlén, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Promoter+anchored+interaction+landscape+of+THP-1+macrophages+captures+early+immune+response+processes%5BTitle%5D)+AND+%22Cell+Immunol%22%5BJournal%5D)">Promoter anchored interaction landscape of THP-1 macrophages captures early immune response processes.</a> Cell Immunol. 355, 104148(2020).</li>
<li>Mezzasoma, L., Talesa, V. N., Romani, R., Bellezza, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Anp+and+BNP+exert+anti-inflammatory+action+via+npr-1%2Fcgmp+axis+by+interfering+with+canonical%2C+non-canonical%2C+and+alternative+routes+of+inflammasome+activation+in+human+THP1+cells%5BTitle%5D)+AND+%22Int+J+Mol+Sci%22%5BJournal%5D)">Anp and BNP exert anti-inflammatory action via npr-1/cgmp axis by interfering with canonical, non-canonical, and alternative routes of inflammasome activation in human THP1 cells.</a> Int J Mol Sci. 22 (1), 1-17 (2021).</li>
<li>Martinat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SUMOylation+of+SAMHD1+at+Lysine+595+is+required+for+HIV-1+restriction+in+non-cycling+cells%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">SUMOylation of SAMHD1 at Lysine 595 is required for HIV-1 restriction in non-cycling cells.</a> Nat Commun. 12 (1), 4582(2021).</li>
<li>Rensen, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clustering+and+reverse+transcription+of+HIV-1+genomes+in+nuclear+niches+of+macrophages%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Clustering and reverse transcription of HIV-1 genomes in nuclear niches of macrophages.</a> EMBO J. 40 (1), e105247(2021).</li>
<li>Ikeda, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((APOBEC3+degradation+is+the+primary+function+of+HIV-1+Vif+determining+virion+infectivity+in+the+myeloid+cell+line+THP-1%5BTitle%5D)+AND+%22mBio%22%5BJournal%5D)">APOBEC3 degradation is the primary function of HIV-1 Vif determining virion infectivity in the myeloid cell line THP-1.</a> mBio. 14 (4), e0078223(2023).</li>
<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+programmable+dual+RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A programmable dual RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337, 816-821 (2012).</li>
<li>Kurosaki, T., Maquat, L. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsense-mediated+mRNA+decay+in+humans+at+a+glance%5BTitle%5D)+AND+%22J+Cell+Sci%22%5BJournal%5D)">Nonsense-mediated mRNA decay in humans at a glance.</a> J Cell Sci. 129 (3), 461-467 (2016).</li>
<li>Tuladhar, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9-based+mutagenesis+frequently+provokes+on-target+mRNA+misregulation%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">CRISPR-Cas9-based mutagenesis frequently provokes on-target mRNA misregulation.</a> Nat Commun. 10 (1), 4056(2019).</li>
<li>Embree, C. M., Abu-Alhasan, R., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Features+and+factors+that+dictate+if+terminating+ribosomes+cause+or+counteract+nonsense-mediated+mRNA+decay%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Features and factors that dictate if terminating ribosomes cause or counteract nonsense-mediated mRNA decay.</a> J Biol Chem. 298 (11), 102592(2022).</li>
<li>Xue, C., Greene, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+repair+pathway+choices+in+CRISPR-Cas9-mediated+genome+editing%5BTitle%5D)+AND+%22Trends+Genet%22%5BJournal%5D)">DNA repair pathway choices in CRISPR-Cas9-mediated genome editing.</a> Trends Genet. 37 (7), 639-656 (2021).</li>
<li>Schnoor, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+non-viral+transfection+of+THP-1+cells%5BTitle%5D)+AND+%22J+Immunol+Methods%22%5BJournal%5D)">Efficient non-viral transfection of THP-1 cells.</a> J Immunol Methods. 344 (2), 109-115 (2009).</li>
<li>Tang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+method+for+high+transfection+efficiency+in+THP-1+suspension+cells+without+PMA+treatment%5BTitle%5D)+AND+%22Anal+Biochem%22%5BJournal%5D)">A method for high transfection efficiency in THP-1 suspension cells without PMA treatment.</a> Anal Biochem. 544, 93-97 (2018).</li>
<li>Ji, W., Zhang, L., Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protocol+using+lentivirus+to+establish+THP-1+suspension+cell+lines+for+immunostaining+and+confocal+microscopy%5BTitle%5D)+AND+%22STAR+Protoc%22%5BJournal%5D)">Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.</a> STAR Protoc. 4 (1), 102032(2023).</li>
<li>Guo, C., Ma, X., Gao, F., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Off-target+effects+in+CRISPR%2FCas9+gene+editing%5BTitle%5D)+AND+%22Front+Bioeng+Biotechnol%22%5BJournal%5D)">Off-target effects in CRISPR/Cas9 gene editing.</a> Front Bioeng Biotechnol. 11, (2023).</li>
<li>Synthego Performance Analysis, ICE Analysis. 3.0, Synthego. 
 <a target="_blank" href="https://www.synthego.com/help/citing-ice">https://www.synthego.com/help/citing-ice</a> (2019).</li>
<li>Salamov, A. A., Nishikawa, T., Swindells, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Assessing+protein+coding+region+integrity+in+cDNA+sequencing+projects%5BTitle%5D)+AND+%22Bioinformatics%22%5BJournal%5D)">Assessing protein coding region integrity in cDNA sequencing projects.</a> Bioinformatics. 14, 384-390 (1998).</li>
<li>Pedersen, A. G., Nielsen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Neural+network+prediction+of+translation+initiation+sites+in+eukaryotes%3A+Perspectives+for+EST+and+genome+analysis%5BTitle%5D)+AND+%22Proc+Int+Conf+Intell+Syst+Mol+Biol%22%5BJournal%5D)">Neural network prediction of translation initiation sites in eukaryotes: Perspectives for EST and genome analysis.</a> Proc Int Conf Intell Syst Mol Biol. 5, 226-233 (1997).</li>
<li>Concordet, J. P., Haeussler, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPOR%3A+Intuitive+guide+selection+for+CRISPR%2FCas9+genome+editing+experiments+and+screens%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens.</a> Nucleic Acids Res. 46 (W1), W242-W245 (2018).</li>
<li>Laguette, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SAMHD1+is+the+dendritic-+and+myeloid-cell-specific+HIV-1+restriction+factor+counteracted+by+Vpx%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx.</a> Nature. 474 (7353), 654-657 (2011).</li>
<li>Hrecka, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Vpx+relieves+inhibition+of+HIV-1+infection+of+macrophages+mediated+by+the+SAMHD1+protein%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein.</a> Nature. 474 (7353), 658-661 (2011).</li>
<li>Seki, A., Rutz, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Optimized+RNP+transfection+for+highly+efficient+CRI+SPR%2FCas9-mediated+gene+knockout+in+primary+T+cells%5BTitle%5D)+AND+%22J+Exp+Med%22%5BJournal%5D)">Optimized RNP transfection for highly efficient CRI SPR/Cas9-mediated gene knockout in primary T cells.</a> J Exp Med. 215 (3), 985-997 (2018).</li>
<li>Batista Napotnik, T., Polajžer, T., Miklavčič, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Cell+death+due+to+electroporation+-+A+review%5BTitle%5D)+AND+%22Bioelectrochemistry%22%5BJournal%5D)">Cell death due to electroporation - A review.</a> Bioelectrochemistry. 141, 107871(2021).</li>
<li>Perretta-Tejedor, N., Freke, G., Seda, M., Long, D. A., Jenkins, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generating+mutant+renal+cell+lines+using+CRISPR+technologies%5BTitle%5D)+AND+%22Methods+Mol+Biol%22%5BJournal%5D)">Generating mutant renal cell lines using CRISPR technologies.</a> Methods Mol Biol. 2067, 323-340 (2020).</li>
<li>Sentmanat, M. F., Peters, S. T., Florian, C. P., Connelly, J. P., Pruett-Miller, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+survey+of+validation+strategies+for+CRISPR-Cas9+editing%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">A survey of validation strategies for CRISPR-Cas9 editing.</a> Sci Rep. 8 (1), 888(2018).</li>
<li>Makino, S., Fukumura, R., Gondo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Illegitimate+translation+causes+unexpected+gene+expression+from+on-target+out-of-frame+alleles+created+by+CRISPR-Cas9%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9.</a> Sci Rep. 6, 39608(2016).</li>
<li>Bowling, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Downstream+alternate+start+site+allows+N-terminal+nonsense+variants+to+escape+NMD+and+results+in+functional+recovery+by+readthrough+and+modulator+combination%5BTitle%5D)+AND+%22J+Pers+Med%22%5BJournal%5D)">Downstream alternate start site allows N-terminal nonsense variants to escape NMD and results in functional recovery by readthrough and modulator combination.</a> J Pers Med. 12 (9), 1448(2022).</li>
<li>Inácios, Â, et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nonsense+mutations+in+close+proximity+to+the+initiation+codon+fail+to+trigger+full+nonsense-mediated+mRNA+decay%5BTitle%5D)+AND+%22J+Biol+Chem%22%5BJournal%5D)">Nonsense mutations in close proximity to the initiation codon fail to trigger full nonsense-mediated mRNA decay.</a> J Biol Chem. 279 (31), 32170-32180 (2004).</li>
<li>Li, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Efficient+inversions+and+duplications+of+mammalian+regulatory+DNA+elements+and+gene+clusters+by+CRISPR%2FCas9%5BTitle%5D)+AND+%22J+Mol+Cell+Biol%22%5BJournal%5D)">Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.</a> J Mol Cell Biol. 7 (4), 284-298 (2015).</li>
<li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer%2Fpromoter+function%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162 (4), 900-910 (2015).</li>
</ol>

<table><tbody><tr><td>0.2 &micro;m spuitfilter</td><td>ClearLine</td><td>146560</td><td>_</td></tr><tr><td>0.4 % trypanblauw</td><td>Beckman Coulter</td><td>383200</td><td>_</td></tr><tr><td>1.5 mL buis</td><td>Eppendorf</td><td>3810X</td><td>_</td></tr><tr><td>24-well plate</td><td>Corning</td><td>353047</td><td>_</td></tr><tr><td>6x TriTrack DNA Loading Dye</td><td>Thermo scientific</td><td>R1161</td><td>_</td></tr><tr><td>75 cm&sup2; Cultuurfles met geventileerde dop</td><td>Corning</td><td>353136</td><td>_</td></tr><tr><td>8-Strip PCR Tubes met doppen</td><td>Life technologies</td><td>AM12230</td><td>_</td></tr><tr><td>96-well platen Platte bodem</td><td>Corning</td><td>353072</td><td>_</td></tr><tr><td>96-well platen Ronde bodem</td><td>Corning</td><td>353077</td><td>_</td></tr><tr><td>Agarose</td><td>Euromedex</td><td>D5</td><td>_</td></tr><tr><td>ATGpr</td><td>_</td><td>_</td><td>https://atgpr.dbcls.jp/</td></tr><tr><td>ChemiDoc Imaging System</td><td>BIO-RAD</td><td>12003153</td><td>_</td></tr><tr><td>Tellende glijbaan</td><td>NanoEntek</td><td>DHC-N04</td><td>_</td></tr><tr><td>CRISPOR</td><td>_</td><td>_</td><td>http://crispor.gi.ucsc.edu/</td></tr><tr><td>DPBS</td><td>Gibco</td><td>14190094</td><td>_</td></tr><tr><td>Ensembl</td><td>EMBL-EBI</td><td>_</td><td>https://www.ensembl.org/index.html</td></tr><tr><td>Fetal bovien serum</td><td>Sigma-Aldrich</td><td>F7524</td><td>_</td></tr><tr><td>FlowJo</td><td>BD Life Sciences</td><td>v10.10</td><td>_</td></tr><tr><td>GeneRuler 100 bp Plus DNA Ladder</td><td>Thermo scientific</td><td>SM0323</td><td>_</td></tr><tr><td>Genome Data Viewer</td><td>NCBI</td><td>_</td><td>https://www.ncbi.nlm.nih.gov/gdv/</td></tr><tr><td>GraphPad Prism</td><td>Dotmatics</td><td>_</td><td>Versie 9.3.1</td></tr><tr><td>Herculase II Fusion DNA Polymerases</td><td>Agilent</td><td>600679</td><td>_</td></tr><tr><td>ICE CRISPR Analyse Tool</td><td>Synthego</td><td>_</td><td>https://www.synthego.com/products/bioinformatics/crispr-analysis</td></tr><tr><td>Image Lab Touch</td><td>BIO-RAD</td><td>_</td><td>Versie 2.4.0.03</td></tr><tr><td>NEBuffer 2</td><td>New England Biolabs</td><td>B7002S</td><td>Inbegrepen bij T7EI M0302S</td></tr><tr><td>Neon Kit, 10 &micro;L</td><td>Invitrogen</td><td>MPK1025K</td><td>Electroporatie kit met tips, buizen, buffer R en E</td></tr><tr><td>Neon Transfectie Systeem</td><td>Invitrogen</td><td>MPK5000</td><td>_</td></tr><tr><td>NetStart 1.0</td><td>_</td><td>_</td><td>https://services.healthtech.dtu.dk/services/NetStart-1.0/</td></tr><tr><td>Nuclease-vrij Water</td><td>Synthego</td><td>_</td><td>_</td></tr><tr><td>PCR primer (EGFP)</td><td>Eurofins</td><td>_</td><td>Fw : GGAATGCAAGGTCTGTTGAATG ; Rev : CACCTTGATGCCGTTCTTCT</td></tr><tr><td>PCR primer (SAMHD1)</td><td>Eurofins</td><td>_</td><td>Fw : CGGGATTGATTTGAGGACGA ; Rev : GGGTGGCAAGTTAGTGAAGA</td></tr><tr><td>Penicilline-streptomycine (10.000 U/mL)</td><td>Gibco</td><td>15140122</td><td>_</td></tr><tr><td>PFA</td><td>Electron Microscopy Sciences</td><td>15714</td><td>_</td></tr><tr><td>PMA</td><td>Sigma-Aldrich</td><td>P8139</td><td>_</td></tr><tr><td>PrimerQuest</td><td>IDT</td><td>_</td><td>https://eu.idtdna.com/pages/tools/primerquest</td></tr><tr><td>QIAquick PCR Zuivering Kit</td><td>Qiagen</td><td>28104</td><td>_</td></tr><tr><td>QuickExtract DNA Extractie Oplossing</td><td>Biosearch Technologies</td><td>QE09050</td><td>_</td></tr><tr><td>RPMI 1640, GlutaMAX</td><td>Gibco</td><td>61870010</td><td>_</td></tr><tr><td>SnapGene Viewer</td><td>Dotmatics</td><td>_</td><td>Versie 7</td></tr><tr><td>SpCas9 2NLS Nuclease</td><td>Synthego</td><td>_</td><td>_</td></tr><tr><td>SYBR Safe DNA Gel Stain</td><td>Invitrogen</td><td>S33102</td><td>_</td></tr><tr><td>Synthetische sgRNA (EGFP)</td><td>Synthego</td><td>_</td><td>#1 : CGCGCCGAGGUGAAGUUCGA ; #2 : UUCAAGUCCGCCAUGCCCGA ; #3 : CAACUACAAGACCCGCGCCG</td></tr><tr><td>Synthetische sgRNA (SAMHD1)</td><td>Synthego</td><td>_</td><td>#1 : AUCGCAACGGGGACGCUUGG ; #2 : GCAGUCAAGAACCUCGGCGC ; #3 : CCAUCCCGACUACAAGACAU</td></tr><tr><td>Spuit Plastipak Luer Lock</td><td>BD</td><td>301229</td><td>_</td></tr><tr><td>T100 Thermische Cycler</td><td>BIO-RAD</td><td>1861096</td><td>_</td></tr><tr><td>T7 endonuclease I</td><td>New England Biolabs</td><td>M0302S</td><td>_</td></tr><tr><td>TAE buffer UltraPure, 10x</td><td>Invitrogen</td><td>15558026</td><td>400 mM Tris-Acetaat, 10 mM EDTA</td></tr><tr><td>THP-1 cellen</td><td>ATCC</td><td>TIB-202</td><td>_</td></tr><tr><td>Trypsine-EDTA (0,05 %)</td><td>Gibco</td><td>25300054</td><td>_</td></tr><tr><td>ZE5 Cell Analyzer</td><td>BIO-RAD</td><td>12014135</td><td>_</td></tr></tbody></table>

op elektroporatie gebaseerde crispr-cas9-gemedieerde genknock-out in thp-1-cellen en isolatie van eencellige klonen

Electroporation-Based CRISPR-Cas9-Mediated Gene Knockout in THP-1 Cells and Single-Cell Clone Isolation

Op elektroporatie gebaseerde CRISPR-Cas9-gemedieerde genknock-out in THP-1-cellen en isolatie van eencellige klonen

The human acute monocytic leukemia (AML) THP-1 cell line is widely used as a model to study the functions of human monocyte-derived macrophages, including ...

electroporation-based-crispr-cas9-mediated-gene-knockout-thp-1-cells

Research

JoVE Journal

Immunology and Infection

In this video, we demonstrate all-in-one CRISPR-Cas9 based genome editing in cultured cells where Cas9 and sgRNA are provided as a single plasmid construct to the cells. The CRISPR-Cas9 system and desired gene to be inserted was introduced in cells through electroporation technique to facilitate successful gene editing.

All-in-One CRISPR Genome Editing: A Method for Homology Directed Repair-Based Gene Knock-In in Cultured Cells Using CRISPR-Cas9 System

This video demonstrates an assay for performing gene editing in human T cells using the CRISPR-Cas9 technology. A mixture of primary CD4+ and CD8+ T cells is combined with a CRISPR-Cas9 ribonucleoprotein complex, targeting specific genes for knockout. Upon electroporation, the sgRNA guides Cas9 to the target DNA sequence, creating precise cuts. These cuts are then repaired by the cell's non-homologous end-joining mechanism, leading to gene knockout.

A CRISPR-Cas9 Technique for Gene Editing in T Cells

Genotypering techniek beschreven voor koppeling fluorescent polymerasekettingreactie (PCR) met capillaire gelelektroforese, maakt genotypering van nuclease-gemedieerde knockout klonen. Het omzeilt beperkingen geconfronteerd met andere genotyperingstechnieken en kosteneffectiever is dan sequencing methoden.

Gebruikmaking van een fluorescentie PCR-capillaire gelelektroforese techniek voor CRISPR Genotype / Cas9-gemedieerde knockout mutanten in een High-throughput Format

Recente vooruitgang in het vermogen om somatische cellijnen genetisch te manipuleren, biedt een groot potentieel voor basis en toegepast onderzoek. Hier presenteren wij twee benaderingen voor CRISPR / Cas9 gegenereerde knockout productie en screening in zoogdiercellijnen, met en zonder het gebruik van selecteerbare markers.

Selectieafhankelijke en onafhankelijke generatie van CRISPR / Cas9-gemedieerde Gene Knockouts in zoogdiercellen

Dit protocol beschrijft in detail de generatie van voetafdruk-vrije geïnduceerde pluripotente stamcellen (iPSCs) van menselijke pancreatic cellen onder feeder-vrije, gevolgd door bewerken met behulp van CRISPR/Cas9 ribonucleoproteins en karakterisering van de gewijzigde eencellige klonen.

Efficiënte generatie en het bewerken van Feeder-vrije IPSCs van menselijke Pancreatic cellen met behulp van de CRISPR-Cas9-systeem

Een protocol voor snelle CRISPR/Cas9-gemedieerde gene verstoring van muis en mens primaire hematopoietische cellen wordt beschreven in dit artikel. Cas9-sgRNA ribonucleoproteins worden ingevoerd via electroporation met sgRNAs gegenereerd via in vitro transcriptie en commerciële Cas9. Hoge bewerken rendementen worden bereikt met beperkte tijd en de financiële kosten.

Hoogefficiënte Gene verstoring van lymfkliertest en menselijke hematopoïetische voorlopercellen door CRISPR/Cas9

Hier presenteren we een protocol om genetisch wijzigen van primaire of uitgebreide menselijke natural killer (NK) cellen met behulp van Cas9 Ribonucleoproteins (Cas9/RNPs). Met behulp van dit protocol, we genereerden menselijke NK cellen tekort voor Transformeren groeifactor-b receptor 2 (TGFBR2) en hypoxanthine phosphoribosyltransferase 1 (HPRT1).

Generatie van Knock-out primaire en uitgebreide menselijke NK-cellen met behulp van Cas9 Ribonucleoproteins

Hier gepresenteerd is een protocol voor efficiënte SCHERPEr/Cas9 ribonucleoproteã-gemedieerde gen bewerken in zoogdiercellen met behulp van buis Electroporation.

SCHERPEr/Cas9 Ribonucleoproteã-gemedieerde nauwkeurige Gene bewerking door buis Electroporation

De gepresenteerde methode beschrijft het genereren van een CRISPR-gemedieerde gen-knock-out in de menselijke embryonale stamcel (hESC) lijn H9, die sgRNA's gericht op het L2HGDH-gen stabiel tot expressie brengt met behulp van een zeer efficiënt lentiviraal-gemedieerd genafgiftesysteem.

CRISPR-Cas9 gemedieerde gendeletie in menselijke pluripotente stamcellen gekweekt onder feedervrije omstandigheden

Hier schetsen we een uitgebreid protocol voor het genereren en gebruiken van in het laboratorium gemanipuleerde glioblastoom-organoïden (LEGO) om genotype-fenotype-afhankelijkheden te onderzoeken en potentiële geneesmiddelen voor de behandeling van glioblastoom te screenen.

In het laboratorium gemanipuleerde glioblastoom organoïdecultuur en screening van geneesmiddelen

Er is een gedetailleerd protocol voorzien voor het gebruik van CRISPR/Cas9-technologie om zeer efficiënte, gerichte knock-in van grote, multicistronische constructies in primaire menselijke T-cellen te bereiken via de homologie-gemedieerde eindjoining (HMEJ) DNA-reparatieroute. T-cellen die met dit cGMP-aanpasbare protocol zijn ontwikkeld, behouden een uitstekende celexpansie, cytotoxiciteit en cytokineproductie.

Niet-virale engineering van primaire menselijke T-cellen via homologie-gemedieerde end-joining gerichte integratie van grote DNA-sjablonen

Leer CRISPR-Cas9-genbewerking in THP-1-cellen via elektroporatie voor onderzoek naar HIV-resistentie bij macrofagen. Dit protocol maakt efficiënte genknock-out en isolatie van eencellige klonen mogelijk.

Op elektroporatie gebaseerde CRISPR-Cas9-gemedieerde genknock-out in THP-1-cellen en isolatie van eencellige klonen

Meer video's verkennen